About   Help   FAQ
Cdc42bpbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc42bpbem1(IMPC)J
Name: CDC42 binding protein kinase beta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812907
Synonyms: Cdc42bpbem1J
Gene: Cdc42bpb  Location: Chr12:111259410-111344152 bp, - strand  Genetic Position: Chr12, 60.94 cM
Alliance: Cdc42bpbem1(IMPC)J page
IMPC: Cdc42bpb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cdc42bpb-8192J-M1439 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACATATTACGCATGCGGGA, TACCGGCTCCTTACATCTGG, TACTTTCCTGGTTAGATCCG and GCATATTGCTGGGCTTTGGA, which resulted in a 589 bp deletion beginning at Chromosome 12 negative strand position 111,345,857 bp CTTCCAAAGCCCAGCAATAT, and ending after TTTCCCCCCCTCCCGCATGC at 111,345,269 bp (GRCm38/mm10). This mutation deletes exon 2 and 497 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cdc42bpb Mutation:  60 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory