Tctn3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tctn3em1(IMPC)J |
Name: |
tectonic family member 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5812886 |
Synonyms: |
Tctn3em1J |
Gene: |
Tctn3 Location: Chr19:40584890-40600677 bp, - strand Genetic Position: Chr19, 34.25 cM
|
Alliance: |
Tctn3em1(IMPC)J page
|
IMPC: |
Tctn3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Tctn3-8161J-M2441 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAGCAGTAGTTTAAAGG, CTTATTAACTAAAAGTAAGA, GCATTCCCAGGAAAGCCCAA and CCTACCCGCTGTCTCCCGGT, which resulted in a 448 bp deletion beginning at Chromosome 19 negative strand position 40,611,575 bp TGGGCTTTCCTGGGAATGCT, and ending after AACATTAGTAATTTCATGAG at 40,611,128 bp (GRCm38/mm10). This mutation deletes exon 3 and 329 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion 10 bases before the 448 bp deletion and a 13 bp deletion 3 bases after the 448 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 114 and early truncation 43 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|