About   Help   FAQ
Tctn3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tctn3em1(IMPC)J
Name: tectonic family member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812886
Synonyms: Tctn3em1J
Gene: Tctn3  Location: Chr19:40584890-40600677 bp, - strand  Genetic Position: Chr19, 34.25 cM
Alliance: Tctn3em1(IMPC)J page
IMPC: Tctn3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tctn3-8161J-M2441 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAGCAGTAGTTTAAAGG, CTTATTAACTAAAAGTAAGA, GCATTCCCAGGAAAGCCCAA and CCTACCCGCTGTCTCCCGGT, which resulted in a 448 bp deletion beginning at Chromosome 19 negative strand position 40,611,575 bp TGGGCTTTCCTGGGAATGCT, and ending after AACATTAGTAATTTCATGAG at 40,611,128 bp (GRCm38/mm10). This mutation deletes exon 3 and 329 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion 10 bases before the 448 bp deletion and a 13 bp deletion 3 bases after the 448 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 114 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tctn3 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory