Rgs19em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rgs19em1(IMPC)J |
| Name: |
regulator of G-protein signaling 19; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5812668 |
| Synonyms: |
Rgs19em1J |
| Gene: |
Rgs19 Location: Chr2:181330212-181335770 bp, - strand Genetic Position: Chr2, 103.72 cM
|
| Alliance: |
Rgs19em1(IMPC)J page
|
| IMPC: |
Rgs19 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Rgs19-8147J-M5764 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGCATCATCCTGCCCAG, AATACCCTGACGTCTTCCCA, GGTTATATCTTGAGCCCCAG and GGGCCCAGTGAATTCTAGAG, which resulted in a 500 bp deletion beginning at Chromosome 2 negative strand position 181,691,465 bp, TCCTGGACCCCTGGGGCTCA, and ending after CCTGCCACAGCATCATCCTG at 181,690,966 bp (GRCm38/mm10). This mutation deletes exon 3 and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base (C) insertion at the site of the 500 bp deletion that will have no effect on the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 10 and early truncation 22 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|