Slc26a10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc26a10^em1(IMPC)J
• Name: solute carrier family 26, member 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812587
• Synonyms: Slc26a10^em1J
• Gene: Slc26a10 Location: Chr10:127007262-127016514 bp, - strand Genetic Position: Chr10, 74.5 cM
• Alliance: Slc26a10^em1(IMPC)J page
• IMPC: Slc26a10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slc26a10-8158J-F2393 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTGGCAGATATATCGTG, ATTGTGTTGGTCCTTTTCGG, GGTCTTCTAAGAGAGCGGAT and GCAGCAGCCAGGAACCGATG, which resulted in a 444 bp deletion beginning at Chromosome 10 positive strand position 127,178,593 bp, CGATATATCTGCCACTCCGG, and ending after CTGGTGCAGCAGCCAGGAAC at 127,179,036 bp (GRCm38/mm10). This mutation deletes exon 3 and 286 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 144 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc26a10 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)