About   Help   FAQ
Reps2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Reps2em1(IMPC)J
Name: RALBP1 associated Eps domain containing protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812581
Synonyms: Reps2em1J
Gene: Reps2  Location: ChrX:161194950-161426645 bp, - strand  Genetic Position: ChrX, 74.67 cM
Alliance: Reps2em1(IMPC)J page
IMPC: Reps2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Reps2-8146J-M5750 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTTTAGCAAGGTTATAGTG, TAGGATTAGATCCTTTCAGC, GTTTTTCCTGTTATGAAATG and AAAATAAAGATGACAAACGC, which resulted in a 616 bp deletion beginning at Chromosome X negative strand position 162,565,597 bp, TTCAAAAGAGGAGGAATAAT, and ending after TCAGCTGGCAGTTAAGGTAG at 162,564,982 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp insertion (AT) before the deletion and a 20 bp deletion (TATTCTTTAGCAAGGTTATA) after the 616 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 78 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Reps2 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory