Arv1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Arv1em1(IMPC)J |
| Name: |
ARV1 homolog, fatty acid homeostasis modulator; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5810348 |
| Synonyms: |
Arv1em1J |
| Gene: |
Arv1 Location: Chr8:125448878-125460862 bp, + strand Genetic Position: Chr8, 72.81 cM
|
| Alliance: |
Arv1em1(IMPC)J page
|
| IMPC: |
Arv1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Arv1-8104J-M9010 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTAAAGAAGCCGTGAGCCG, GCTGCGGTAGGTATGCCTCT, TTAGTGGCTGAGCTGAGATA and GCATTACTAGTTGTCTCACC, which resulted in a 290 bp deletion beginning at Chromosome 8 positive strand position 124,728,265bp TCTTGGCATGCCCTCGGCTC and ending after AATCAAAGCTAAGACCTGGT at 124,728,554 bp (GRCm38/mm10). This mutation deletes exon 3 and 154 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 2 bp deletion in intron 4 after the 290 bp deletion that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 93 and early truncation 18 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|