Efhc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Efhc2^em1(IMPC)J
• Name: EF-hand domain (C-terminal) containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5810347
• Synonyms: Efhc2^em1J
• Gene: Efhc2 Location: ChrX:16998288-17185607 bp, - strand Genetic Position: ChrX, 12.34 cM, cytoband A1.3
• Alliance: Efhc2^em1(IMPC)J page
• IMPC: Efhc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Efhc2-8032J-F7960 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAGGATCCCAAAAAGTAC, GGGAGGATCCCAAAAAGTAC, ATAAATTCCTGCTAGCCAAA and ATTTGGCTAGCAGGAATTTA, which resulted in a 379 bp deletion beginning at Chromosome X negative strand position 17,230,771 bp TTCCTGCTAGCCAAATGGCT, and ending after CCCAAATGGTGGCCACAGAA at 17,230,393 bp (GRCm38/mm10). This mutation deletes exon 4 and 155 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 17 bp deletion 53 bp before the 379 bp deletion and will not alter the effect of the 379 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 127 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Efhc2 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)