About   Help   FAQ
Efhc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Efhc2em1(IMPC)J
Name: EF-hand domain (C-terminal) containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5810347
Synonyms: Efhc2em1J
Gene: Efhc2  Location: ChrX:16998288-17185607 bp, - strand  Genetic Position: ChrX, 12.34 cM, cytoband A1.3
Alliance: Efhc2em1(IMPC)J page
IMPC: Efhc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Efhc2-8032J-F7960 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAGGATCCCAAAAAGTAC, GGGAGGATCCCAAAAAGTAC, ATAAATTCCTGCTAGCCAAA and ATTTGGCTAGCAGGAATTTA, which resulted in a 379 bp deletion beginning at Chromosome X negative strand position 17,230,771 bp TTCCTGCTAGCCAAATGGCT, and ending after CCCAAATGGTGGCCACAGAA at 17,230,393 bp (GRCm38/mm10). This mutation deletes exon 4 and 155 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 17 bp deletion 53 bp before the 379 bp deletion and will not alter the effect of the 379 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 127 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Efhc2 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory