About   Help   FAQ
Acy3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acy3em1(IMPC)J
Name: aminoacylase 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5810346
Synonyms: Acy3em1J
Gene: Acy3  Location: Chr19:4036570-4040007 bp, + strand  Genetic Position: Chr19, 3.7 cM
Alliance: Acy3em1(IMPC)J page
IMPC: Acy3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Acy3-8100J-M3948 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAAGTGAGACATACATG, GCTAACTTCTCACCTTTGGT, GTTTCCCCTCAAGAAGGCCT and GCCCTCCTTCCTGCCCCCTA, which resulted in a 437 bp deletion beginning at Chromosome 19 positive strand position 3,987,498 bp, ATGGGGAACAGGACCAACAT, and ending after TACCTACAGGTGGTCCCTAG at 3,987,934 bp (GRCm38/mm10). This mutation deletes exon 2 and 244 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 63 bp deletion 154 bp downstream of the 437 bp deletion. Overall this mutation is predicted to cause a change of amino acid sequence after residue 79 and early truncation 110 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Acy3 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory