Acy3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Acy3em1(IMPC)J |
| Name: |
aminoacylase 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5810346 |
| Synonyms: |
Acy3em1J |
| Gene: |
Acy3 Location: Chr19:4036570-4040007 bp, + strand Genetic Position: Chr19, 3.7 cM
|
| Alliance: |
Acy3em1(IMPC)J page
|
| IMPC: |
Acy3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Acy3-8100J-M3948 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAAGTGAGACATACATG, GCTAACTTCTCACCTTTGGT, GTTTCCCCTCAAGAAGGCCT and GCCCTCCTTCCTGCCCCCTA, which resulted in a 437 bp deletion beginning at Chromosome 19 positive strand position 3,987,498 bp, ATGGGGAACAGGACCAACAT, and ending after TACCTACAGGTGGTCCCTAG at 3,987,934 bp (GRCm38/mm10). This mutation deletes exon 2 and 244 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 63 bp deletion 154 bp downstream of the 437 bp deletion. Overall this mutation is predicted to cause a change of amino acid sequence after residue 79 and early truncation 110 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|