Actg2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Actg2em1(IMPC)J |
Name: |
actin, gamma 2, smooth muscle, enteric; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5807486 |
Synonyms: |
Actg2em1J |
Gene: |
Actg2 Location: Chr6:83489891-83513233 bp, - strand Genetic Position: Chr6, 35.94 cM
|
Alliance: |
Actg2em1(IMPC)J page
|
IMPC: |
Actg2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Actg2-8089J-M2448 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGATTGTGAAGAAAAACC, CAGGATTGTGAAGAAAAACC, ACCCCATATCCACTTCCCAT and ACAGATCTGCTGTGGTTGGG, which resulted in a 484 bp deletion beginning at Chromosome 6 negative strand position 83,523,034 bp CATGGGAAGTGGATATGGGG, and ending after GAGTTCCCAACAGAGAGTCC at 83,522,551 bp (GRCm38/mm10). This mutation deletes exon 5 and 399 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp deletion 40 bp before the start of the 484 bp deletion that will not alter the result of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 40 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|