About   Help   FAQ
Dnajb2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnajb2em1(IMPC)J
Name: DnaJ heat shock protein family (Hsp40) member B2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5807189
Synonyms: Dnajb2em1J
Gene: Dnajb2  Location: Chr1:75213050-75222336 bp, + strand  Genetic Position: Chr1, 38.64 cM, cytoband C3
Alliance: Dnajb2em1(IMPC)J page
IMPC: Dnajb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dnajb2-8031J-M7944 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATATCCCTGGCACACCACA, GGTGTTGGACTAAGCAAAAA, GAAGGAGTACCAAGAATGAA and CATGTTATGTCTGTCTAGCA, which resulted in a 319 bp deletion beginning at Chromosome 1 positive strand position 75,237,297 bp GGCACACCACAGGGAGAGAA, and ending after GTCCCCCTGCTTCCATTCAT at 75,237,615 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dnajb2 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory