Dnajb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnajb2^em1(IMPC)J
• Name: DnaJ heat shock protein family (Hsp40) member B2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5807189
• Synonyms: Dnajb2^em1J
• Gene: Dnajb2 Location: Chr1:75213050-75222336 bp, + strand Genetic Position: Chr1, 38.64 cM, cytoband C3
• Alliance: Dnajb2^em1(IMPC)J page
• IMPC: Dnajb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CATATCCCTGGCACACCACA, CATGTTATGTCTGTCTAGCA, GAAGGAGTACCAAGAATGAA, and GGTGTTGGACTAAGCAAAAA that targeted exon(s) ENSMUSE00000629573.2. This resulted in deletion(s) of 3 bp (location: Chr1:75214507-75214509; GRCm39), 319 bp (location: Chr1:75213941-75214259; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dnajb2 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)