About   Help   FAQ
Zfp711em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp711em1(IMPC)J
Name: zinc finger protein 711; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5807188
Synonyms: Zfp711em1J
Gene: Zfp711  Location: ChrX:111510259-111544767 bp, + strand  Genetic Position: ChrX, 48.76 cM
Alliance: Zfp711em1(IMPC)J page
IMPC: Zfp711 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp711-8046J-F4983 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGATGTTGTCACAGATGA, CTGATGTTGTCACAGATGAT, AGATATCATTAAGTAGTCTT and TTCTACTGTTACCATAAAAA, which resulted in a 439 bp internal deletion beginning at Chromosome X positive strand position 112,614,979 bp, ACAGATGATGGGATAACTCT, and ending after TGTCAAGAGCACTTCTGAAG at 112,615,417 bp (GRCm38/mm10). This mutation deletes 439 bp from exon 3, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp711 Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory