About   Help   FAQ
Zc4h2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc4h2em1(IMPC)J
Name: zinc finger, C4H2 domain containing; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5807187
Synonyms: Zc4h2em1J
Gene: Zc4h2  Location: ChrX:94682799-94702115 bp, - strand  Genetic Position: ChrX, 41.99 cM
Alliance: Zc4h2em1(IMPC)J page
IMPC: Zc4h2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zc4h2-7995J-F9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG, which resulted in a 381 bp deletion beginning at Chromosome X negative strand position 95,643,567 bp CTGGAGTCTGTCCTATTATC, and ending after GTCAGAATACACGACCTATT at 95,643,187 bp (GRCm38/mm10). This mutation deletes exon 3 and 208 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zc4h2 Mutation:  3 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory