Zc4h2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc4h2^em1(IMPC)J
• Name: zinc finger, C4H2 domain containing; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5807187
• Synonyms: Zc4h2^em1J
• Gene: Zc4h2 Location: ChrX:94682799-94702115 bp, - strand Genetic Position: ChrX, 41.99 cM
• Alliance: Zc4h2^em1(IMPC)J page
• IMPC: Zc4h2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zc4h2-7995J-F9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG, which resulted in a 381 bp deletion beginning at Chromosome X negative strand position 95,643,567 bp CTGGAGTCTGTCCTATTATC, and ending after GTCAGAATACACGACCTATT at 95,643,187 bp (GRCm38/mm10). This mutation deletes exon 3 and 208 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zc4h2 Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)