Cep135em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cep135em1(IMPC)J |
Name: |
centrosomal protein 135; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5805217 |
Synonyms: |
Cep135em1J |
Gene: |
Cep135 Location: Chr5:76736545-76794313 bp, + strand Genetic Position: Chr5, 41.31 cM
|
Alliance: |
Cep135em1(IMPC)J page
|
IMPC: |
Cep135 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Cep135-8015J-M4780 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTCTTTCAGGGTATCAAA, GGCCTGTTTTGAGAAACTTG, CTAACCACAGTTCTATTCAT and CCTAAAAACCAAAGAGGGCA, which resulted in a 383 bp deletion beginning at Chromosome 5 positive strand position 76,593,055 bp, TTTGAGAAACTTGAGGACCCT, and ending after TAATGAAGGCTCCTTGCCCTC at 76,593,437 bp (GRCm38/mm10). This mutation deletes exon 2 and 192 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 4 bp deletion (GAAT) 88 bp 3-prime of the 383 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|