Mlh1em1Jcs
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mlh1em1Jcs |
| Name: |
mutL homolog 1; endonuclease-mediated mutation 1, John C Schimenti |
| MGI ID: |
MGI:5804170 |
| Synonyms: |
Mlh1V384D |
| Gene: |
Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
|
| Alliance: |
Mlh1em1Jcs page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Using an sgRNA (targeting CGCTTACCAGATGGTCCGTA) and ssODN template (CACGACAGGGGTGGCTTCCTCATCCACTAGTGGAAGTGGCGACAAGGTCTACGCTTACCAGATGGATCGTACGGACTCCCGGGAGCAGAAGCTTGACGCCTTTCTGCAGCCTGTAAGCAGCCTTGGG) with CRISPR/Cas9 technology, valine codon 384 (GTC) was changed to aspartic acid (GAT) (c.1151_1152delTCinsAT, p.V384D). This mutation mimics human SNP rs63750447.
(J:226562)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mlh1 Mutation: |
41 strains or lines available
|
|
| Original: |
J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6 |
| All: |
1 reference(s) |
|