About   Help   FAQ
Mlh1em1Jcs
Endonuclease-mediated Allele Detail
Summary
Symbol: Mlh1em1Jcs
Name: mutL homolog 1; endonuclease-mediated mutation 1, John C Schimenti
MGI ID: MGI:5804170
Synonyms: Mlh1V384D
Gene: Mlh1  Location: Chr9:111057296-111100854 bp, - strand  Genetic Position: Chr9, 60.92 cM
Alliance: Mlh1em1Jcs page
Mutation
origin
Strain of Origin:  FVB/NJ x B6(Cg)-Tyrc-2J/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting CGCTTACCAGATGGTCCGTA) and ssODN template (CACGACAGGGGTGGCTTCCTCATCCACTAGTGGAAGTGGCGACAAGGTCTACGCTTACCAGATGGATCGTACGGACTCCCGGGAGCAGAAGCTTGACGCCTTTCTGCAGCCTGTAAGCAGCCTTGGG) with CRISPR/Cas9 technology, valine codon 384 (GTC) was changed to aspartic acid (GAT) (c.1151_1152delTCinsAT, p.V384D). This mutation mimics human SNP rs63750447. (J:226562)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mlh1 Mutation:  41 strains or lines available
References
Original:  J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory