About   Help   FAQ
Ccdc59em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc59em1(IMPC)J
Name: coiled-coil domain containing 59; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5804139
Synonyms: Ccdc59-, Ccdc59em1J
Gene: Ccdc59  Location: Chr10:105677340-105683371 bp, + strand  Genetic Position: Chr10, 55.12 cM
Alliance: Ccdc59em1(IMPC)J page
IMPC: Ccdc59 gene page
Ccdc59em1(IMPC)J/Ccdc59em1(IMPC)J mice exhibit embryonic lethality, with no embryos seen at E9.5 and only a small percentage of necrotic embryos at E7.5. Embryos fail to gastrulate, are smaller, with absent egg cylinders, head folds, primitive node, and primitive streak formation at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccdc59-8014J-F4739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, AATGTTTTACTGACGACACA and TGAGGAATTTCTGAAGACGG, which resulted in a 495 bp deletion beginning at Chromosome 10 positive strand position 105,842,368 bp, CTTATATTTAGGTAAAGGGC, and ending after AGGAAGGTAAGCACCTCCGT at 105,842,862 bp (GRCm38/mm10). This mutation deletes exon 2 and 188 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc59 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory