Ccdc59em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccdc59em1(IMPC)J |
| Name: |
coiled-coil domain containing 59; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5804139 |
| Synonyms: |
Ccdc59-, Ccdc59em1J |
| Gene: |
Ccdc59 Location: Chr10:105677340-105683371 bp, + strand Genetic Position: Chr10, 55.12 cM
|
| Alliance: |
Ccdc59em1(IMPC)J page
|
| IMPC: |
Ccdc59 gene page |
|
Ccdc59em1(IMPC)J/Ccdc59em1(IMPC)J mice exhibit embryonic lethality, with no embryos seen at E9.5 and only a small percentage of necrotic embryos at E7.5. Embryos fail to gastrulate, are smaller, with absent egg cylinders, head folds, primitive node, and primitive streak formation at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ccdc59-8014J-F4739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, AATGTTTTACTGACGACACA and TGAGGAATTTCTGAAGACGG, which resulted in a 495 bp deletion beginning at Chromosome 10 positive strand position 105,842,368 bp, CTTATATTTAGGTAAAGGGC, and ending after AGGAAGGTAAGCACCTCCGT at 105,842,862 bp (GRCm38/mm10). This mutation deletes exon 2 and 188 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|