Ccdc59^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc59^em1(IMPC)J
• Name: coiled-coil domain containing 59; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804139
• Synonyms: Ccdc59^-, Ccdc59^em1J
• Gene: Ccdc59 Location: Chr10:105677340-105683371 bp, + strand Genetic Position: Chr10, 55.12 cM
• Alliance: Ccdc59^em1(IMPC)J page
• IMPC: Ccdc59 gene page

Ccdc59^em1(IMPC)J/Ccdc59^em1(IMPC)J mice exhibit embryonic lethality, with no embryos seen at E9.5 and only a small percentage of necrotic embryos at E7.5. Embryos fail to gastrulate, are smaller, with absent egg cylinders, head folds, primitive node, and primitive streak formation at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AATGTTTTACTGACGACACA, CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, and TGAGGAATTTCTGAAGACGG that targeted exon(s) ENSMUSE00000098899.4. This resulted in deletion(s) of 2 bp (location: Chr10:105678054-105678055; GRCm39), 495 bp (location: Chr10:105678229-105678723; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc59 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)