About   Help   FAQ
Ahsa1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ahsa1em1(IMPC)J
Name: AHA1, activator of heat shock protein ATPase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5804023
Synonyms: Ahsa1em1J
Gene: Ahsa1  Location: Chr12:87313253-87320772 bp, + strand  Genetic Position: Chr12, 41.47 cM
Alliance: Ahsa1em1(IMPC)J page
IMPC: Ahsa1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ahsa1-8007J-M4644 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACTTTTAGGAATCCAAA, GGTGACTGCAAGGTTAAAGG, GGATCAGAGCTATGGCAACG and AGCGGCATTGGGCACTCAGT, which resulted in a 428 bp deletion beginning at Chromosome 12 positive strand position 87,268,069 bp, CTCCTTTAACCTTGCAGTCA, and ending after TGGGCACTCAGTGGGACGC at 87,268,496 bp (GRCm38/mm10). This mutation deletes exon 2 and 237 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTTTGGATTC) 62 bp 5-prime of the 428 bp deletion that will not alter the results of the large deletion. This mutation is predicted to cause a change of amino acid sequence after residue 27 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ahsa1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory