Ahsa1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ahsa1em1(IMPC)J |
| Name: |
AHA1, activator of heat shock protein ATPase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5804023 |
| Synonyms: |
Ahsa1em1J |
| Gene: |
Ahsa1 Location: Chr12:87313253-87320772 bp, + strand Genetic Position: Chr12, 41.47 cM
|
| Alliance: |
Ahsa1em1(IMPC)J page
|
| IMPC: |
Ahsa1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ahsa1-8007J-M4644 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACTTTTAGGAATCCAAA, GGTGACTGCAAGGTTAAAGG, GGATCAGAGCTATGGCAACG and AGCGGCATTGGGCACTCAGT, which resulted in a 428 bp deletion beginning at Chromosome 12 positive strand position 87,268,069 bp, CTCCTTTAACCTTGCAGTCA, and ending after TGGGCACTCAGTGGGACGC at 87,268,496 bp (GRCm38/mm10). This mutation deletes exon 2 and 237 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTTTGGATTC) 62 bp 5-prime of the 428 bp deletion that will not alter the results of the large deletion. This mutation is predicted to cause a change of amino acid sequence after residue 27 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|