Dock9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dock9^em1(IMPC)J
• Name: dedicator of cytokinesis 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804021
• Synonyms: Dock9^em1J
• Gene: Dock9 Location: Chr14:121779458-122035249 bp, - strand Genetic Position: Chr14, 65.28 cM
• Alliance: Dock9^em1(IMPC)J page
• IMPC: Dock9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dock9-7743J-F670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATAGCAGAGTATGACAC, TTGTCTGCTGGCCGTGTGGG, GCTGAACTTTTATGTCTCTA and AACCAGTGAAACACGACCCT, which resulted in a 439 bp deletion beginning at Chromosome 14 negative strand position 121,662,767 bp, GTCGTGTTTCACTGGTTCAG, and ending after GACCCAGTGTCATACTCTGC at 121,662,329 bp GRCm38/mm10). This mutation deletes exon 4 and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp insertion (TAACTCGG) at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 111 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dock9 Mutation: 91 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)