About   Help   FAQ
Iqsec2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Iqsec2em1(IMPC)J
Name: IQ motif and Sec7 domain 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803878
Synonyms: Iqsec2em1J
Gene: Iqsec2  Location: ChrX:150927193-151008232 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Iqsec2em1(IMPC)J page
IMPC: Iqsec2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Iqsec2-RI-8041J-M4925 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTGAGTGAATGAACCGTGT, TCTAGTGTACTCACTCAGTT, GGTTGGGGTGTGGCTCTTGA and AGATGGCTCTGGTTGAAAAA, which resulted in a 519 bp deletion beginning at Chromosome X positive strand position 152,202,730 bp, GAACCGTGTAGGCAGTGAAG, and ending after GTTGGGGTGTGGCTCTTGAG at 152,203,248 bp (GRCm38/mm10). This mutation deletes exon 3 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 245 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Iqsec2 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory