About   Help   FAQ
Abcd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Abcd3em1(IMPC)J
Name: ATP-binding cassette, sub-family D member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803796
Synonyms: Abcd3em1J
Gene: Abcd3  Location: Chr3:121552423-121608951 bp, - strand  Genetic Position: Chr3, 52.94 cM, cytoband G-H1
Alliance: Abcd3em1(IMPC)J page
IMPC: Abcd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Abcd3-7998J-F9901 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCATTCACTTTCTCTTGT, AACAACAATGCTTAACTACA, TTAACATTCTGCAATGCATT and CAGTAACTTGGTGAAGCTCT, which resulted in a 219 bp deletion beginning at Chromosome 3 negative strand position 121,791,897 bp, CAAGAGCTTCACCAAGTTAC, and ending after TAGTTTGCCTTGTAGTTAAG at 121,791,679 bp (GRCm38/mm10). This mutation deletes exon 4 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 27 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abcd3 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory