Abcd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abcd3^em1(IMPC)J
• Name: ATP-binding cassette, sub-family D member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5803796
• Synonyms: Abcd3^em1J
• Gene: Abcd3 Location: Chr3:121552423-121608951 bp, - strand Genetic Position: Chr3, 52.94 cM, cytoband G-H1
• Alliance: Abcd3^em1(IMPC)J page
• IMPC: Abcd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Abcd3-7998J-F9901 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCATTCACTTTCTCTTGT, AACAACAATGCTTAACTACA, TTAACATTCTGCAATGCATT and CAGTAACTTGGTGAAGCTCT, which resulted in a 219 bp deletion beginning at Chromosome 3 negative strand position 121,791,897 bp, CAAGAGCTTCACCAAGTTAC, and ending after TAGTTTGCCTTGTAGTTAAG at 121,791,679 bp (GRCm38/mm10). This mutation deletes exon 4 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Abcd3 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)