About   Help   FAQ
Garre1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Garre1em1(IMPC)J
Name: granule associated Rac and RHOG effector 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803794
Synonyms: 4931406P16Rikem1J
Gene: Garre1  Location: Chr7:33936132-34012976 bp, - strand  Genetic Position: Chr7, 19.48 cM
Alliance: Garre1em1(IMPC)J page
IMPC: Garre1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project 4931406P16Rik-7996J-M9596 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTTCTCAGGTAGCAGGG, AATAGAAGCCTAAACTCTGA, CGTATTAGTCACTCAGTAAC and GTTATCTCTGGGGGTCTCAC, which resulted in a 346 bp deletion beginning at Chromosome 7 negative strand position 34,254,222 bp, GGGGTCTCACTGGTCTCACTG, and ending after TGCACTTCTCAGGTAGCAG at 34,253,877 bp (GRCm38/mm10). This mutation deletes exon 8 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 418 and early truncation 63 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Garre1 Mutation:  47 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory