About   Help   FAQ
AU040320em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: AU040320em1(IMPC)J
Name: expressed sequence AU040320; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803696
Synonyms: AU040320em1J
Gene: AU040320  Location: Chr4:126647331-126763487 bp, + strand  Genetic Position: Chr4, 60.94 cM
Alliance: AU040320em1(IMPC)J page
IMPC: AU040320 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project AU040320-7997J-M0236 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTCACAGTAATCTCGTGC, TTCGATTCTGCCTCAGATGC, GACAACTGTTTTCGTTAGAG and TTGCTCATGCATAGATGCGG, which resulted in a 614 bp deletion beginning at Chromosome 4 positive strand position 126,791,731 bp, CTCGTGCTGGGTTCTTCCTA, and ending after TTAAATCTATTCCTCCGCAT at 126,792,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 93 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp (TAGAGCGGAAGCTGCTCATTATCTGTTC) deletion 129 bp after the 614 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any AU040320 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory