About   Help   FAQ
Slc44a2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc44a2em1(IMPC)J
Name: solute carrier family 44, member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5796295
Synonyms: Slc44a2em1J
Gene: Slc44a2  Location: Chr9:21232015-21266324 bp, + strand  Genetic Position: Chr9, 7.77 cM
Alliance: Slc44a2em1(IMPC)J page
IMPC: Slc44a2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Slc44a2-7954J-F6530 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGAAGAAGCTGGAGAGCCG, TGTGTCTGCATGCTACCAAC, TTTGCCGGAGAACACACACT and CACATCCCTCGTGGGGAAGA, which resulted in a 231 bp deletion beginning at Chromosome 9 positive strand position 21,338,315 bp TGTAGTCCCCTGTTGGTAGC, and ending after TGGGGAGATGTGTCCCAGTG at 21,338,545 bp (GRCm38/mm10). This mutation deletes exon 2 and 182 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion (A) at the site of the deletion that will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 13 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc44a2 Mutation:  49 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/15/2024
MGI 6.24
The Jackson Laboratory