Gabarapl1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gabarapl1em1(IMPC)J |
| Name: |
GABA type A receptor associated protein like 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5796285 |
| Synonyms: |
Gabarapl1em1J |
| Gene: |
Gabarapl1 Location: Chr6:129510155-129519294 bp, + strand Genetic Position: Chr6, 63.39 cM
|
| Alliance: |
Gabarapl1em1(IMPC)J page
|
| IMPC: |
Gabarapl1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Gabarapl1-7880J-F7865 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAAAAGTCATTCACCCTA, AACTACAAATTACCTATAAA, GGGTTGTCACTGCATGTAGG and GTGAGCTGGCCAGTACAGAT, which resulted in a 368 bp deletion beginning at Chromosome 6 positive strand position 129,537,347 bp, GTAATTTGTAGTTGTTTAAA, and ending after GAGCTGGCCAGTACAGATAG at 129,537,714 bp (GRCm38/mm10). This mutation deletes exon 2 and 79 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion G at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 30 and early truncation 6 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|