About   Help   FAQ
Acadsbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acadsbem1(IMPC)J
Name: acyl-Coenzyme A dehydrogenase, short/branched chain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795947
Synonyms: Acadsbem1J
Gene: Acadsb  Location: Chr7:131012330-131047940 bp, + strand  Genetic Position: Chr7, 74.03 cM, cytoband F4
Alliance: Acadsbem1(IMPC)J page
IMPC: Acadsb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsat The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATACATAGAGGAAAGCAATT, TGCAGAAGACGCATACATAG, CCACGACCAGAGGGGCAAGA and AGATGTGCTCATCTCTGCGG, which resulted in a 233 bp deletion beginning at Chromosome 7 positive strand position 131,424,431bp CTCTATGTATGCGTCTTCTG, and ending after TCAACTTCACCCTCTTGCCC at 131,424,663 bp (GRCm38/mm10). This mutation deletes exon 2 and 73 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (CTGC) 49 bp after the 233 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 14 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Acadsb Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory