Acadsbem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Acadsbem1(IMPC)J |
| Name: |
acyl-Coenzyme A dehydrogenase, short/branched chain; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5795947 |
| Synonyms: |
Acadsbem1J |
| Gene: |
Acadsb Location: Chr7:131012330-131047940 bp, + strand Genetic Position: Chr7, 74.03 cM, cytoband F4
|
| Alliance: |
Acadsbem1(IMPC)J page
|
| IMPC: |
Acadsb gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATACATAGAGGAAAGCAATT, TGCAGAAGACGCATACATAG, CCACGACCAGAGGGGCAAGA and AGATGTGCTCATCTCTGCGG, which resulted in a 233 bp deletion beginning at Chromosome 7 positive strand position 131,424,431bp CTCTATGTATGCGTCTTCTG, and ending after TCAACTTCACCCTCTTGCCC at 131,424,663 bp (GRCm38/mm10). This mutation deletes exon 2 and 73 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (CTGC) 49 bp after the 233 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 14 and early truncation 25 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|