Tnks1bp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tnks1bp1em1(IMPC)J |
| Name: |
tankyrase 1 binding protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5795838 |
| Synonyms: |
Tnks1bp1em1J |
| Gene: |
Tnks1bp1 Location: Chr2:84878366-84903392 bp, + strand Genetic Position: Chr2, 49.45 cM
|
| Alliance: |
Tnks1bp1em1(IMPC)J page
|
| IMPC: |
Tnks1bp1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project Tnks1bp1-7965J-M7446 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACTTGCACCTAGAACGAT, AGGTTGGAGTGTGGAAGATT, ATTCAGGCAAACCCAGGCTA and ATAGCCCCTTTAAGACTTCA, which resulted in a 837 bp deletion beginning at Chromosome 2 positive strand position 85,051,847 bp ATTCGGTGCAGCAGGAGTCA, and ending after TTCAGGCAAACCCAGGCTAA at 85,052,683 bp (GRCm38/mm10). This mutation deletes exon 3 and 206 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp deletion (GAACGATG) 24 bp before the 837 bp del and an 8 bp insertion (GCTTCCTT) at the site of the 837 bp del, which will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 32 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|