Cnot12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cnot12^em1(IMPC)J
• Name: CCR4-NOT transcription complex subunit 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795838
• Synonyms: Tnks1bp1^em1J
• Gene: Cnot12 Location: Chr2:84878366-84903392 bp, + strand Genetic Position: Chr2, 49.45 cM
• Alliance: Cnot12^em1(IMPC)J page
• IMPC: Cnot12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGGTTGGAGTGTGGAAGATT, ATAGCCCCTTTAAGACTTCA, ATTCAGGCAAACCCAGGCTA, and TGACTTGCACCTAGAACGAT that targeted exon(s) ENSMUSE00001235545.2. This resulted in deletion(s) of 8 bp (location: Chr2:84882159-84882166; GRCm39), 837 bp (location: Chr2:84882191-84883027; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cnot12 Mutation: 54 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)