About   Help   FAQ
Sarafem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sarafem1(IMPC)J
Name: store-operated calcium entry-associated regulatory factor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795835
Synonyms: Sarafem1J
Gene: Saraf  Location: Chr8:34621733-34638001 bp, + strand  Genetic Position: Chr8, 20.9 cM, cytoband A3
Alliance: Sarafem1(IMPC)J page
IMPC: Saraf gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Saraf-7950J- F6680 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGAGACTAGGTCTACT, CTTCTTAGACTGCTGGCGGG, GTTAACCTCCTCTTCAAACC and ACCCATGGACCCGCTGAGCA, which resulted in a 501 bp deletion beginning at Chromosome 8 positive strand position 34,165,102 bp TAGACCTAGTCTCTGACGTT, and ending after GGCCAGTCACGTGCCTGGTT at 34,165,602 bp (GRCm38/mm10). This mutation deletes exon 3 and 101 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp deletion (CCGC) 26 bp before the 501 bp deletion which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 109 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Saraf Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory