Saraf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Saraf^em1(IMPC)J
• Name: store-operated calcium entry-associated regulatory factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795835
• Synonyms: Saraf^em1J
• Gene: Saraf Location: Chr8:34621733-34638001 bp, + strand Genetic Position: Chr8, 20.9 cM, cytoband A3
• Alliance: Saraf^em1(IMPC)J page
• IMPC: Saraf gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACCCATGGACCCGCTGAGCA, CGTCAGAGACTAGGTCTACT, CTTCTTAGACTGCTGGCGGG, and GTTAACCTCCTCTTCAAACC that targeted exon(s) ENSMUSE00000210506.4 ENSMUSE00001704860.1. This resulted in deletion(s) of 4 bp (location: Chr8:34632226-34632229; GRCm39), 501 bp (location: Chr8:34632256-34632756; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Saraf Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)