Sarafem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Sarafem1(IMPC)J |
Name: |
store-operated calcium entry-associated regulatory factor; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5795835 |
Synonyms: |
Sarafem1J |
Gene: |
Saraf Location: Chr8:34621733-34638001 bp, + strand Genetic Position: Chr8, 20.9 cM, cytoband A3
|
Alliance: |
Sarafem1(IMPC)J page
|
IMPC: |
Saraf gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Saraf-7950J- F6680 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGAGACTAGGTCTACT, CTTCTTAGACTGCTGGCGGG, GTTAACCTCCTCTTCAAACC and ACCCATGGACCCGCTGAGCA, which resulted in a 501 bp deletion beginning at Chromosome 8 positive strand position 34,165,102 bp TAGACCTAGTCTCTGACGTT, and ending after GGCCAGTCACGTGCCTGGTT at 34,165,602 bp (GRCm38/mm10). This mutation deletes exon 3 and 101 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp deletion (CCGC) 26 bp before the 501 bp deletion which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 109 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|