Tbc1d31em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tbc1d31em1(IMPC)J |
| Name: |
TBC1 domain family, member 31; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5795760 |
| Synonyms: |
Tbc1d31em1J |
| Gene: |
Tbc1d31 Location: Chr15:57775595-57833463 bp, + strand Genetic Position: Chr15, 24.08 cM
|
| Alliance: |
Tbc1d31em1(IMPC)J page
|
| IMPC: |
Tbc1d31 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tbc1d31-7960J-M8930 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGTCACAAACTTTACAG, GAAATGGCTGTATTAGTATC, AGCTTCAGAAGGCAAACAGG and CTGAGGCAACACAGACTGGG, which resulted in a 170 bp deletion beginning at Chromosome 15 negative strand position 57,920,067 bp GCAAACAGGAGGACTTCTTA, and ending after GCTGTATTAGTATCAGGAAG at 57,919,898 bp (GRCm38/mm10). This mutation deletes exon 3 and 54 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp deletion (GACTGGGAC) 43 bp before the 170 bp deletion and a 31 bp deletion (CAGTGGTGGAGTTCTCAGAGGGGAAAAGGAG) 22 bp after the 170 bp deletion, which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 74 and early truncation 6 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|