About   Help   FAQ
Tbc1d31em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d31em1(IMPC)J
Name: TBC1 domain family, member 31; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795760
Synonyms: Tbc1d31em1J
Gene: Tbc1d31  Location: Chr15:57775595-57833463 bp, + strand  Genetic Position: Chr15, 24.08 cM
Alliance: Tbc1d31em1(IMPC)J page
IMPC: Tbc1d31 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tbc1d31-7960J-M8930 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGTCACAAACTTTACAG, GAAATGGCTGTATTAGTATC, AGCTTCAGAAGGCAAACAGG and CTGAGGCAACACAGACTGGG, which resulted in a 170 bp deletion beginning at Chromosome 15 negative strand position 57,920,067 bp GCAAACAGGAGGACTTCTTA, and ending after GCTGTATTAGTATCAGGAAG at 57,919,898 bp (GRCm38/mm10). This mutation deletes exon 3 and 54 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp deletion (GACTGGGAC) 43 bp before the 170 bp deletion and a 31 bp deletion (CAGTGGTGGAGTTCTCAGAGGGGAAAAGGAG) 22 bp after the 170 bp deletion, which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 74 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tbc1d31 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory