About   Help   FAQ
Tubb2aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tubb2aem1(IMPC)J
Name: tubulin, beta 2A class IIA; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795759
Synonyms: Tubb2aem1J
Gene: Tubb2a  Location: Chr13:34258261-34261991 bp, - strand  Genetic Position: Chr13, 14.03 cM
Alliance: Tubb2aem1(IMPC)J page
IMPC: Tubb2a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tubb2a-7712J-F7081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTTGTCTGCATGCTGGT, CTGCTTTCTCTGTCACGGTA, CTGTCACCAGAAAGACAGCA and AGAGATTCTAAGCATGATGT, which resulted in a 170 bp deletion beginning at Chromosome 13 negative strand position 34,076,680 bp ATGTGGGATTGTCTTCATTT, and ending after GTCTCGCTTTCCATACCGTG at 34,076,511 bp (GRCm38/mm10). This mutation deletes exon 2 and 61 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tubb2a Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory