About   Help   FAQ
Cachd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cachd1em1(IMPC)J
Name: cache domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795757
Synonyms: Cachd1em1J
Gene: Cachd1  Location: Chr4:100633870-100861741 bp, + strand  Genetic Position: Chr4, 45.76 cM
Alliance: Cachd1em1(IMPC)J page
IMPC: Cachd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cachd1-7843J-M9819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACATATAAACGACACCC, AAACACCTGGACATCATGGT, GCAAGTAATGAGAGATTCAC and ATCTCTATATTTAAACTTGT, which resulted in a 498 bp deletion beginning at Chromosome 4 positive strand position 100,897,481 bp CTACCATGATGTCCAGGTGT, and ending after CTTGTCGGCTTCTGCCCGTG at 100,897,978 bp (GRCm38/mm10). This mutation deletes exon 3 and 349 bp of flanking intronic sequence including the splice acceptor and donor, there is a single bp insertion T at this site, which will not effect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 101 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cachd1 Mutation:  82 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory