Cachd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cachd1^em1(IMPC)J
• Name: cache domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795757
• Synonyms: Cachd1^em1J
• Gene: Cachd1 Location: Chr4:100633870-100861741 bp, + strand Genetic Position: Chr4, 45.76 cM
• Alliance: Cachd1^em1(IMPC)J page
• IMPC: Cachd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cachd1-7843J-M9819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACATATAAACGACACCC, AAACACCTGGACATCATGGT, GCAAGTAATGAGAGATTCAC and ATCTCTATATTTAAACTTGT, which resulted in a 498 bp deletion beginning at Chromosome 4 positive strand position 100,897,481 bp CTACCATGATGTCCAGGTGT, and ending after CTTGTCGGCTTCTGCCCGTG at 100,897,978 bp (GRCm38/mm10). This mutation deletes exon 3 and 349 bp of flanking intronic sequence including the splice acceptor and donor, there is a single bp insertion T at this site, which will not effect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 101 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cachd1 Mutation: 82 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)