About   Help   FAQ
Rprd1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rprd1aem1(IMPC)J
Name: regulation of nuclear pre-mRNA domain containing 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5792573
Synonyms: Rprd1aem1J
Gene: Rprd1a  Location: Chr18:24618017-24663261 bp, - strand  Genetic Position: Chr18, 13.18 cM
Alliance: Rprd1aem1(IMPC)J page
IMPC: Rprd1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rprd1a-7936J-F7112 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTTATGTGGCTGATGAG, AGCGTTCATACAGTGTGTGA, CGCTGCTACTAACATCTCCA and GATGAGTGTGTTCGGAGAAG, which resulted in a 333 bp deletion beginning at Chromosome 18 negative strand position 24,510,041 bp, TAGCAGCGACGTGATGAGTG, and ending after TAAAGCGTTCATACAGTGTG at 24,509,709 bp (GRCm38/mm10). This mutation deletes exon 2 and 203 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (A) at the site of the deletion and another insertion (T) 37 bp before the 333 bp deletion that will not alter the result of the mutation. This 333 bp deletion is predicted to cause a change of amino acid sequence after residue 50 and early truncation 28 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rprd1a Mutation:  50 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory