About   Help   FAQ
Serp2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serp2em1(IMPC)J
Name: stress-associated endoplasmic reticulum protein family member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790709
Synonyms: Serp2em1J
Gene: Serp2  Location: Chr14:76770254-76794329 bp, - strand  Genetic Position: Chr14, 40.44 cM
Alliance: Serp2em1(IMPC)J page
IMPC: Serp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Serp2-7951J-M6651 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGAGGACAGCGGAGAACAC, CCTTAAACCTTAATCTTTAT, GTACGTGCTGAGGCTCCTAC and GACAGACTCTTGGATCCTAC, which resulted in a 222 bp deletion beginning at Chromosome 14 negative strand position 76,550,173 bp GATCCAAGAGTCTGTCACTC, and ending after TCACTGAATTATAGCCTGTG at 76,549,952 bp (GRCm38/mm10). This mutation deletes exon 2 and 149 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serp2 Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory