Serp2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Serp2em1(IMPC)J |
| Name: |
stress-associated endoplasmic reticulum protein family member 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5790709 |
| Synonyms: |
Serp2em1J |
| Gene: |
Serp2 Location: Chr14:76770254-76794329 bp, - strand Genetic Position: Chr14, 40.44 cM
|
| Alliance: |
Serp2em1(IMPC)J page
|
| IMPC: |
Serp2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Serp2-7951J-M6651 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGAGGACAGCGGAGAACAC, CCTTAAACCTTAATCTTTAT, GTACGTGCTGAGGCTCCTAC and GACAGACTCTTGGATCCTAC, which resulted in a 222 bp deletion beginning at Chromosome 14 negative strand position 76,550,173 bp GATCCAAGAGTCTGTCACTC, and ending after TCACTGAATTATAGCCTGTG at 76,549,952 bp (GRCm38/mm10). This mutation deletes exon 2 and 149 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 8 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|