About   Help   FAQ
Rab40bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab40bem1(IMPC)J
Name: Rab40B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790205
Synonyms: Rab40bem1J
Gene: Rab40b  Location: Chr11:121246951-121279077 bp, - strand  Genetic Position: Chr11, 85.28 cM
Alliance: Rab40bem1(IMPC)J page
IMPC: Rab40b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab40b-7934J-M7095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab40b Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory