Rab11b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab11b^em1(IMPC)J
• Name: RAB11B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790204
• Synonyms: Rab11b^em1J
• Gene: Rab11b Location: Chr17:33961458-33979460 bp, - strand Genetic Position: Chr17, 17.98 cM
• Alliance: Rab11b^em1(IMPC)J page
• IMPC: Rab11b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab11b-7933J-M7053 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGGGGCTGAACTAGAGCA, GTAGGGGCTGAACTAGAGCA, TTACCAGTGTGTCCCAGCGT and CACCCAGCAAACCTGCATGG, which resulted in a 549 bp deletion beginning at Chromosome 17 negative strand position 33,750,102 bp CCAGCGTGGGAAAATCCGTG, and ending after TTCCATTTTCACCCAACCTC at 33,749,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 353 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab11b Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)