Osbpl10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Osbpl10^em1(IMPC)J
• Name: oxysterol binding protein-like 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790203
• Synonyms: Osbpl10^em1J
• Gene: Osbpl10 Location: Chr9:114807637-115061293 bp, + strand Genetic Position: Chr9, 66.84 cM
• Alliance: Osbpl10^em1(IMPC)J page
• IMPC: Osbpl10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Osbpl10-7566J-F3946 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCACGCCATGTGTGCCCCG, TATCCAACCTAGTCATGTGA, GCAGCTGCCAGATAGGACAG and CTGCTACGTGCTTTAAGAGG, which resulted in a 403 bp deletion beginning at Chromosome 9 positive strand position 115,175,848 bp CATGACTAGGTTGGATATTT, and ending after CCTGCCTGGAACTCACCCCTG at 115,176,250 bp (GRCm38/mm10). This mutation deletes exon 4 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Osbpl10 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)