Tbc1d30^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d30^em1(IMPC)J
• Name: TBC1 domain family, member 30; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790099
• Synonyms: Tbc1d30^em1J
• Gene: Tbc1d30 Location: Chr10:121099725-121187183 bp, - strand Genetic Position: Chr10, 69.12 cM, cytoband D3
• Alliance: Tbc1d30^em1(IMPC)J page
• IMPC: Tbc1d30 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tbc1d30-7955J-M6512 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTATGTTCTCTGGAAA, ATTGCGTTCCCAGAAGTGTT, TTGGTTTCTGACGCATCAGG and TGGGCATATTAAAATCCTGG, which resulted in a 349 bp deletion beginning at Chromosome 10 negative strand position 121,297,003bp CATCAGGAGGAACTTTGGTC, and ending after CTATTGCGTTCCCAGAAGTG at 121,296,655bp (GRCm38/mm10). This mutation deletes exon 6 and 180 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 199 and early truncation 29 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbc1d30 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)