About   Help   FAQ
Tbc1d30em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d30em1(IMPC)J
Name: TBC1 domain family, member 30; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790099
Synonyms: Tbc1d30em1J
Gene: Tbc1d30  Location: Chr10:121099725-121187183 bp, - strand  Genetic Position: Chr10, 69.12 cM, cytoband D3
Alliance: Tbc1d30em1(IMPC)J page
IMPC: Tbc1d30 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tbc1d30-7955J-M6512 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTATGTTCTCTGGAAA, ATTGCGTTCCCAGAAGTGTT, TTGGTTTCTGACGCATCAGG and TGGGCATATTAAAATCCTGG, which resulted in a 349 bp deletion beginning at Chromosome 10 negative strand position 121,297,003bp CATCAGGAGGAACTTTGGTC, and ending after CTATTGCGTTCCCAGAAGTG at 121,296,655bp (GRCm38/mm10). This mutation deletes exon 6 and 180 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 199 and early truncation 29 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tbc1d30 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory