About   Help   FAQ
Nars2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nars2em1(IMPC)J
Name: asparaginyl-tRNA synthetase 2 (mitochondrial)(putative); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790096
Synonyms: Nars2-, Nars2em1J
Gene: Nars2  Location: Chr7:96600712-96713965 bp, + strand  Genetic Position: Chr7, 53.13 cM
Alliance: Nars2em1(IMPC)J page
IMPC: Nars2 gene page
Nars2em1(IMPC)J/\AlleleSymbol(MGI:5790096|0 mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Nars2-7918J-F3847 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGCTGACATAAGAGAA, ATTCAGAAAAAGACTGCTAG, GTGAAAATGTTAGACCTTAA and GAACTCTTTAGAAAAGAAAG, which resulted in a 365 bp deletion beginning at Chromosome 7 positive strand position 96,955,866 bp CTAGCAGTCTTTTTCTGAAT, and ending after GAACCAGGAGCCCTTAAGGT at 96,956,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 31 amino acids later. There is a single bp (G) insertion 53 bp before the 365 bp deletion that will not alter the results of the deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nars2 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory