Nars2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nars2^em1(IMPC)J
• Name: asparaginyl-tRNA synthetase 2 (mitochondrial)(putative); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790096
• Synonyms: Nars2^-, Nars2^em1J
• Gene: Nars2 Location: Chr7:96600712-96713965 bp, + strand Genetic Position: Chr7, 53.13 cM
• Alliance: Nars2^em1(IMPC)J page
• IMPC: Nars2 gene page

Nars2^em1(IMPC)J/\AlleleSymbol(MGI:5790096|0 mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ATTCAGAAAAAGACTGCTAG, CTCTGGCTGACATAAGAGAA, GAACTCTTTAGAAAAGAAAG, and GTGAAAATGTTAGACCTTAA that targeted exon(s) ENSMUSE00001256960.2. This resulted in deletion(s) of 365 bp (location: Chr7:96605073-96605437; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nars2 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)