About   Help   FAQ
Mpped2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mpped2em1(IMPC)J
Name: metallophosphoesterase domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5789904
Synonyms: Mpped2em1J
Gene: Mpped2  Location: Chr2:106523614-106698701 bp, + strand  Genetic Position: Chr2, 55.8 cM
Alliance: Mpped2em1(IMPC)J page
IMPC: Mpped2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mpped2-7894J-M7436 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTATGATGACTATTACGA, CACCCAAACAGTCTAACGCA, AGACCGGGAAAGGTTAATTG and ATTTCTTGTATGATATGCTG, which resulted in a 356 bp deletion beginning at Chromosome 2 positive strand position 106,744,649bp CGAGGGTTCTGACATGTTTA, and ending after ATTTCTTGTATGATATGCTG at 106,745,004 bp (GRCm38/mm10). This mutation deletes exon 3 and 174 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mpped2 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory