About   Help   FAQ
Ncbp2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ncbp2em1(IMPC)J
Name: nuclear cap binding protein subunit 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5789874
Synonyms: Ncbp2em1J
Gene: Ncbp2  Location: Chr16:31767364-31777290 bp, + strand  Genetic Position: Chr16, 22.4 cM
Alliance: Ncbp2em1(IMPC)J page
IMPC: Ncbp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ncbp2-7920J-M3809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAATCTCTATGTAAATAATC, TCTATGTAAATAATCTGGTT, CCTGAACTGAATCTCTGCCT and CAGGTCTTTTCGTCAGTTTG, which resulted in a 326 bp deletion beginning at Chromosome 16 positive strand position 31,956,177 bp GTAAATAATCTGGTTAGGTT, and ending after TACAGGTCTTTTCGTCAGTTT at 31,956,502 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ncbp2 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory