Pcyox1lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pcyox1lem1(IMPC)J |
| Name: |
prenylcysteine oxidase 1 like; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5788765 |
| Synonyms: |
Pcyox1lem1J |
| Gene: |
Pcyox1l Location: Chr18:61829908-61840706 bp, - strand Genetic Position: Chr18, 34.68 cM
|
| Alliance: |
Pcyox1lem1(IMPC)J page
|
| IMPC: |
Pcyox1l gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Pcyox1l-7923J-M8904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACGGTAAATCCAAGGGC, GCCCAGCCGGATGAGTGTGT, TCCTCTTCAAGGACCCCAGG and GCCTTCCTGATGCAAATGGC, which resulted in a 469 bp deletion beginning at Chromosome 18 negative strand position 61,702,507 bp AAAATAGACAGTTCCAGCCA, and ending after CAGAGCCCCACGTGTCATAC at 61,702,039 bp (GRCm38/mm10). This mutation deletes exon 3 and 294 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 13 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
6 reference(s) |
|