About   Help   FAQ
Pcyox1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcyox1lem1(IMPC)J
Name: prenylcysteine oxidase 1 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788765
Synonyms: Pcyox1lem1J
Gene: Pcyox1l  Location: Chr18:61829908-61840706 bp, - strand  Genetic Position: Chr18, 34.68 cM
Alliance: Pcyox1lem1(IMPC)J page
IMPC: Pcyox1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pcyox1l-7923J-M8904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACGGTAAATCCAAGGGC, GCCCAGCCGGATGAGTGTGT, TCCTCTTCAAGGACCCCAGG and GCCTTCCTGATGCAAATGGC, which resulted in a 469 bp deletion beginning at Chromosome 18 negative strand position 61,702,507 bp AAAATAGACAGTTCCAGCCA, and ending after CAGAGCCCCACGTGTCATAC at 61,702,039 bp (GRCm38/mm10). This mutation deletes exon 3 and 294 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pcyox1l Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory