About   Help   FAQ
Jpt1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Jpt1em1(IMPC)J
Name: Jupiter microtubule associated homolog 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788505
Synonyms: Jpt1em1J
Gene: Jpt1  Location: Chr11:115388179-115405213 bp, - strand  Genetic Position: Chr11, 80.84 cM
Alliance: Jpt1em1(IMPC)J page
IMPC: Jpt1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Hn1-7890J-M7394 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAATCCGTGACTTTAACA, GGCGATCCTTGTTAAAGTCA, ATCGTAAACCCACTGATGGA and GCAGATGGATAAAGCACTGT, which resulted in a 500 bp deletion beginning at Chromosome 11 negative strand position 115,503,346 bp, TGTTGGTACCCTGACCCTCC, and ending after GCGATCCTTGTTAAAGTCAC at 115,502,847 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 3 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Jpt1 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory