About   Help   FAQ
Cercamem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cercamem1(IMPC)J
Name: cerebral endothelial cell adhesion molecule; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788503
Synonyms: Cercamem1J
Gene: Cercam  Location: Chr2:29759176-29772852 bp, + strand  Genetic Position: Chr2, 20.76 cM, cytoband B
Alliance: Cercamem1(IMPC)J page
IMPC: Cercam gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cercam-7869J-F7768 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTCCCCCTCAGTGAACTC, AGGGAATCCTGTCTCAGACT, CTAGGCAGTAAATTTAGGAA and ACTAGCCCTTCTCCTCCACT, which resulted in a 674 bp deletion beginning at Chromosome 2 positive strand position 29,872,506 bp, TGAACTCTGGTCCCGAGTCT, and ending after CCTAAATTTACTGCCTAGTG at 29,873,179 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 334 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 13 bp insertion (agggaatttctca) at the site of the deletion that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 139 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cercam Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory