About   Help   FAQ
Kif15em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kif15em1(IMPC)J
Name: kinesin family member 15; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788421
Synonyms: Kif15em1J
Gene: Kif15  Location: Chr9:122780146-122847798 bp, + strand  Genetic Position: Chr9, 73.31 cM, cytoband F4
Alliance: Kif15em1(IMPC)J page
IMPC: Kif15 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kif15-7892J-M7412 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAGTAGGTCTAGTATT, AGTAACAGGTAAGTTTCCTG, CATTTGAAATATGTAATGTA and CAATTTGTCACTTTTTAGCT, which resulted in a 261 bp deletion beginning at Chromosome 9 positive strand position 122,959,773 bp, GAAACTTACCTGTTACTTTT, and ending after CTTTCATTTGAAATATGTAA at 122,960,033 bp (GRCm38/mm10). This mutation deletes exon 3 and 77 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kif15 Mutation:  61 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory