About   Help   FAQ
Cdc37l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc37l1em1(IMPC)J
Name: cell division cycle 37-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788403
Synonyms: Cdc37l1em1J
Gene: Cdc37l1  Location: Chr19:28967752-29004081 bp, + strand  Genetic Position: Chr19, 23.61 cM, cytoband C2
Alliance: Cdc37l1em1(IMPC)J page
IMPC: Cdc37l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cdc37l1-7867J-M7730 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACCAGTGTGATACATGACA, GTATTGCCTCACAGAAAGAA, CATTATTTACCTTAAATGAG and CATTATTTACCTTAAATGAG, which resulted in a 273 bp deletion beginning at Chromosome 19 negative strand position 29,007,109 bp, ACATTCAAGGTTCATACAGT, and ending after ACATGACAGGGCAAGCCGAG at 29,006,837 bp (GRCm38/mm10). This mutation deletes exon 4 and 157 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 48 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cdc37l1 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory