About   Help   FAQ
Dlatem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dlatem1(IMPC)J
Name: dihydrolipoamide S-acetyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788343
Synonyms: Dlatem1J
Gene: Dlat  Location: Chr9:50545933-50571080 bp, - strand  Genetic Position: Chr9, 27.75 cM
Alliance: Dlatem1(IMPC)J page
IMPC: Dlat gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dlat-7876J-M7804 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTTTTATAAAATATGACCC, CAGCTCAGAACTGACACGTG, GACCTTGTCACCCATCACAA and CTGAATGCTTTTATGCGTCC, which resulted in a 325 bp deletion beginning at Chromosome 9 negative strand position 50,653,854 bp, TTGTGATGGGTGACAAGGTC, and ending after TTGCTGCCTGGGTCATATTT at 50,653,530 bp (GRCm38/mm10). This mutation deletes exon 5 and 198 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7 bp (cgtgtca) intronic deletion 24 bp after the 325 bp deletion that will not alter the result of the mutation. The 325 bp deletion is predicted to cause a change of amino acid sequence after residue 219 and early truncation 30 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dlat Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory