Serpinb9c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpinb9c^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5785013
• Synonyms: Serpinb9c^em1J
• Gene: Serpinb9c Location: Chr13:33333258-33343725 bp, - strand Genetic Position: Chr13, 13.82 cM, cytoband A4
• Alliance: Serpinb9c^em1(IMPC)J page
• IMPC: Serpinb9c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Serpinb9c-7777J-M6430 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGCATGCGAAATAGATGTG, TGGAAGGAATATATTCACCT, TCAAAACAGTGATAATTCAG and TGTTTTGAAGCAGAGAAATA, which resulted in a 285 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 33,157,670 bp, TTCTCTGCTTCAAAACAGTG, and ending after TCCCCAGCCCCACCCCCACAT at 33157670 bp (GRCm38/mm10). This mutation deletes exon 2 and 107 bp of flanking intronic sequence including the splice acceptor and donor. At the site of the 285bp deletion there is a single T insertion, in addition there is a 21 bp deletion (atggaaggaatatattcacct) 32 bp after the 285 bp deletion that should not alter the results of the mutation. The mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Serpinb9c Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)