About   Help   FAQ
Serpinb9cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpinb9cem1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5785013
Synonyms: Serpinb9cem1J
Gene: Serpinb9c  Location: Chr13:33333258-33343725 bp, - strand  Genetic Position: Chr13, 13.82 cM, cytoband A4
Alliance: Serpinb9cem1(IMPC)J page
IMPC: Serpinb9c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Serpinb9c-7777J-M6430 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGCATGCGAAATAGATGTG, TGGAAGGAATATATTCACCT, TCAAAACAGTGATAATTCAG and TGTTTTGAAGCAGAGAAATA, which resulted in a 285 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 33,157,670 bp, TTCTCTGCTTCAAAACAGTG, and ending after TCCCCAGCCCCACCCCCACAT at 33157670 bp (GRCm38/mm10). This mutation deletes exon 2 and 107 bp of flanking intronic sequence including the splice acceptor and donor. At the site of the 285bp deletion there is a single T insertion, in addition there is a 21 bp deletion (atggaaggaatatattcacct) 32 bp after the 285 bp deletion that should not alter the results of the mutation. The mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serpinb9c Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory