Drc7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Drc7em1(IMPC)J |
| Name: |
dynein regulatory complex subunit 7; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5784926 |
| Synonyms: |
Drc7em1J |
| Gene: |
Drc7 Location: Chr8:95781731-95804769 bp, + strand Genetic Position: Chr8, 47.12 cM
|
| Alliance: |
Drc7em1(IMPC)J page
|
| IMPC: |
Drc7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Not Specified
|
| |
|
Mutation details: This allele from project Drc7-7877J-F7837 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGACTTCTTGCTCTTCCG, GCAAGTCTGGGTCTGGGGTA, GCTCAGCAGAGGAGCCGTAG and GCTCTGAGTACAGAGCTGGC, which resulted in a 292 bp deletion around exon 9 beginning at Chromosome 8 positive strand position 95,070,286 bp, CTCTTCCGGGGAAACTGACA, and ending after TCAACACCCTGCCAGCTCTG at 95,070,577 bp (GRCm38/mm10). This mutation deletes exon 9 and 219 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 404 and early truncation 11 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|