About   Help   FAQ
Kctd9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kctd9em1(IMPC)J
Name: potassium channel tetramerisation domain containing 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784897
Synonyms: Kctd9em1J
Gene: Kctd9  Location: Chr14:67953536-67979760 bp, + strand  Genetic Position: Chr14, 34.66 cM
Alliance: Kctd9em1(IMPC)J page
IMPC: Kctd9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Kctd9-7773J-M6328 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGCGCTGAATCTCCTCAA, GCACAGAGTAATTGCCTATC, ACTAGTGACAGCCTTAGAAA and CAGCAGTGACACTACAGCAT, which resulted in a 277 bp deletion around exon 2 beginning at Chromosome 14 positive strand position 67,724,474 bp, CTCCTCAAGGGTCTCTTAAG, and ending after TGAGCTGTCTGTCACCTATG at 67,724,750 bp (GRCm38/mm10). This mutation deletes exon 2 and 155 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base pair (C) deletion in the intron 42 bp before the 277 bp deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kctd9 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory