About   Help   FAQ
Rbm25em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbm25em1(IMPC)J
Name: RNA binding motif protein 25; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784893
Synonyms: Rbm25em1J
Gene: Rbm25  Location: Chr12:83678990-83729901 bp, + strand  Genetic Position: Chr12, 38.81 cM, cytoband D3
Alliance: Rbm25em1(IMPC)J page
IMPC: Rbm25 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Rbm25-7449J-M3912 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAACATTGATGAACCCAGA, CAGCAAGGCAAAATGATTAA, AGTGTTTTATCTACCCACAG and GTCATTGTAATATGTGCTTG, which resulted in a 340 bp deletion around ENSMUSE00001286618 (exon 6) beginning at Chromosome 12 positive strand position 84,992,175 bp, GCTGTATTTTTTCATGTTTTT, and ending after AATATGTGCTTGTGGCTTAT at 84,992,514 bp (GRCm38/mm10). This mutation deletes exon 6 and 182 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (TTTTTTTTTT) and 1bp insertion C in the intron 136 bp before the 340 bp deletion that is not expected to have an effect on the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 127 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rbm25 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory