Aldh1l2^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aldh1l2^{em1(IMPC)Kmpc}
• Name: aldehyde dehydrogenase 1 family, member L2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:5784761
• Synonyms: Aldh1l2^em1Krb, Aldh1l2^em1Nkh, Aldh1l2^tm1Nkh
• Gene: Aldh1l2 Location: Chr10:83323314-83370004 bp, - strand Genetic Position: Chr10, 41.27 cM
• Alliance: Aldh1l2^{em1(IMPC)Kmpc} page
• IMPC: Aldh1l2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences GCAGAAGCTTACCAGTCGGT and GGGCTGTCAATGACATCCAT that targeted exon(s) ENSMUSE00001204693.2 ENSMUSE00001263707.2. This resulted in deletion(s) of 58 bp (location: Chr10:83358649-83358706; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aldh1l2 Mutation: 60 strains or lines available

References

• Original: J:233450 Nam K-H, et al., Direct Data Submission for Alleles from the KRIBB Institute. MGI Direct Data Submission. 2016
• All: 4 reference(s)