About   Help   FAQ
Aldh1l2em1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
Summary
Symbol: Aldh1l2em1(IMPC)Kmpc
Name: aldehyde dehydrogenase 1 family, member L2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
MGI ID: MGI:5784761
Synonyms: Aldh1l2em1Krb, Aldh1l2em1Nkh, Aldh1l2tm1Nkh
Gene: Aldh1l2  Location: Chr10:83323314-83370004 bp, - strand  Genetic Position: Chr10, 41.27 cM
Alliance: Aldh1l2em1(IMPC)Kmpc page
IMPC: Aldh1l2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences GCAGAAGCTTACCAGTCGGT and GGGCTGTCAATGACATCCAT that targeted exon(s) ENSMUSE00001204693.2 ENSMUSE00001263707.2. This resulted in deletion(s) of 58 bp (location: Chr10:83358649-83358706; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Aldh1l2 Mutation:  60 strains or lines available
References
Original:  J:233450 Nam K-H, et al., Direct Data Submission for Alleles from the KRIBB Institute. MGI Direct Data Submission. 2016;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory