About   Help   FAQ
Tmem9bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem9bem1(IMPC)J
Name: TMEM9 domain family, member B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784648
Synonyms: Tmem9bem1J
Gene: Tmem9b  Location: Chr7:109335043-109351470 bp, - strand  Genetic Position: Chr7, 57.47 cM
Alliance: Tmem9bem1(IMPC)J page
IMPC: Tmem9b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Tmem9b-7805J-M0788 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTGCTACATAAACCG, AAACAGAAAGCTCTAGGCCG, ATGGTTTTAGAATATCTGAC and TGGTTTTAGAATATCTGACA, which resulted in a 236 bp deletion around exon 2 beginning at Chromosome 7 negative strand position 109,750,210 bp, TTAGAATATCTGACAGGGAT, and ending after GGTATCACCTGCTACATAAA at 109,749,975 bp (GRCm38/mm10). This mutation deletes exon 2 and 144 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 28 bp insertion (gctcagtcccatctgaaatgaaacctcc) at this site as and a 4 bp deletion 140 bp after the 236 bp deletion, neither of which is expected to alter the result of the 236 bp deletion, which is predicted to cause early truncation after 36 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem9b Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory