Tmem9b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem9b^em1(IMPC)J
• Name: TMEM9 domain family, member B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784648
• Synonyms: Tmem9b^em1J
• Gene: Tmem9b Location: Chr7:109335043-109351470 bp, - strand Genetic Position: Chr7, 57.47 cM
• Alliance: Tmem9b^em1(IMPC)J page
• IMPC: Tmem9b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Tmem9b-7805J-M0788 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTGCTACATAAACCG, AAACAGAAAGCTCTAGGCCG, ATGGTTTTAGAATATCTGAC and TGGTTTTAGAATATCTGACA, which resulted in a 236 bp deletion around exon 2 beginning at Chromosome 7 negative strand position 109,750,210 bp, TTAGAATATCTGACAGGGAT, and ending after GGTATCACCTGCTACATAAA at 109,749,975 bp (GRCm38/mm10). This mutation deletes exon 2 and 144 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 28 bp insertion (gctcagtcccatctgaaatgaaacctcc) at this site as and a 4 bp deletion 140 bp after the 236 bp deletion, neither of which is expected to alter the result of the 236 bp deletion, which is predicted to cause early truncation after 36 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem9b Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)